circad | circRNAs associated with diseases

Hsa-circRNA11783-2
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Coronary artery disease and type 2 Diabetes mellitus	ICD-10	Atherosclerotic cardiovascular disease, so described (I25)
DBLink	Link to database	PMID	28777011
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	peripheral blood from 6 control individuals, 6 coronary artery disease patients, 6 type 2 diabetes mellitus patients and 6 coronary artery disease combined with type 2 diabetes mellitus patients
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGCTTCTGGGACGTCTAAACA Reverse TGCAGCTGTAAAGCACTCTTTC	Statistics	Fold Change : Upregulated pvalue : p<0.001
Citation
Li, X, Zhao, Z, Jian, D, Li, W, Tang, H, Li, M (2017). Hsa-circRNA11783-2 in peripheral blood is correlated with coronary artery disease and type 2 diabetes mellitus. Diab Vasc Dis Res, 14, 6:510-515.